Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231988
Length 463 bp
Fasta Format > whe10h10
ttcggcacgagggagagagaaaagcagcgagnacgcgaatcagcggcggc gatggctctcccggcgtccggctccaccctctcccgcttcctctcctccc gccgcatccagcccacggacatcaccgccctcgccacctggggcgtcttc gccggcagcgccgccatctacctcgtccagccattcgactggatcaagaa gaccttctttgagaagcccgagccagaggcatgagtgtcatacattgcaa cttttgatgcctacattttcaggacgattctctgagtttggatgacccag ccaataatatacaagaccctcgtgttcccttgtttgatttcccatccaga tgtaggtttcctcttgcgttgcatgtaaccctcaccatgggaggggaatg atcatgtaaattttatttgccgtcacagagaaaagaaactgtgcttcgtg tttaaaaaaaaaa
Download
page-top