Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231983
Length 659 bp
Fasta Format > whe10g21
ggttggccgcagacagcagcagctcgcctccttccttccttcctcctcac tcccccctatatacccgccaccctacccgtcggagggtgcgcgcagcggt ggagctcggtggattgtcggggcaaatgggttccagttccagggccgccc tcttctgcttcctggccgtcgcctcctccctcctgcaccccgccagatct gacggggaggacaaccagctcctcaaggggatcaacagctacagagcttc actcaaggtcccggcgctcaccgagaacagcaatgccgactgcctggccg agcagctagcgaagaagttcaagggccaggagtgcaccaacaccaccgga gccaacaccgtccccggcaccgagccgcagttccccgactacccccagtt cctcgaccgctgccacctcaacgcgtcggtgaccgaggacgggcaggtga tgccggcatgcgtgcccggactcgtggccgacgttgtgctgaccaactac accaagtcacagtacaaccggttcctcaacgacaccaagtactccggcgt cgggatcgccaacgagggggactgggtggtcgtcgtgctcagcaccagca ccgactccggcgactactcccctgctcccccgggctccaactgggctcct tcggtccag
Download
page-top