Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231979
Length 619 bp
Fasta Format > whe10g15
gcgcacgcacgcgtccacgaataaaggccgagggcggcgagccaggccca atcgccaaaaaccctagcgccgatccgatccgatcgagctctgcctcccc tcccatggcggcccccccgagccaggcgagcctcctgctccagaagcagc tccgagatctagcgaagaaccccgtggacgggttctcggcggggctggtg gacgacggcaacgtgtttgagtggcaggtcaccatcatcggcccgcccga aacattatatgatggaggctacttcaatgcagtaatgacctttcctcagg attatcccaacagtcctccatcagtaaggtttacttctgagatgtggcat ccaaacgtctatcctgatgggcgtgtgtgcatttctattcttcatccacc tggtgatgatcccaatggttacgagcttgcaagtgaacggtggacacctg tgcacacagttgagagtatagttttgagcattatttcgatgctctctagt ccaaacgatgagtctccagcaaatattgaagcggctaaggactggagaga aaagagggccgagttcaagaaaaaggtgaggagccttgttcgcaaatctc aggaaatgctctgaaaaag
Download
page-top