Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231978
Length 363 bp
Fasta Format > whe10g14
caggtcctttgacagtgcgtaaagaataccgcaaagtacttccttctttc ataaggccatctgcatcttactccacacaagcttcagaaaaaagaccaaa acaggagagaacagacttgacgactgttgaagatccctttaatgcgccta cctacaatatacctgagaagccagtgacatttgtcgagggcgcctcttac agtgttgtaatacttgctgggcttggagttgctgcattggctggatacgc tgttttcaaagagcttatatttgaaccaaaagagtacaagatttttggga aagctctagcaagagttcanagtgatagccaggttacagccaaaattggt taccctataactg
Download
page-top