Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231972
Length 640 bp
Fasta Format > whe10g07
gacaaatctccgcctcccctcccctccccggccgcagcagagcgccatgt cgtcctcccctacccccgcgccagacgccggcgccgccgcgatggccgtc gacgactcgtcggagaccgaccagctcgactccatgtccacggaggacat cgtccgggccacccgcctcctcgacaacgaggtccgcgtcctcaaggacg agctgcagcggaacaacctggagctcgagaacgtcaaggacaagatcaag gagaatcaggagaaaataaagctcaacaagcagctgccctacctcgtcgg caacatcgtcgagattttggaaatgaaccctgaagatgaggctgaagagg atggtgctaatatagatctggactcacagaggaaaggaaaatgtgttgtt cttaagacatccacaagacagactatattccttcctgtgatcgggctagt tgaccctgacaacctcaagcctggtgatttggttggagtcaacaaggaca gctacttgatattagacacgctaccttcggagtatgactctcgagtaaag gcaatggaggtagatgaaaagcctacggaggattataatgacattggtgg ccttgagaaagagattcaggaactcgttgaagctatagtg
Download
page-top