Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231969
Length 642 bp
Fasta Format > whe10g02
aggaattcggcacgaggcagcagtgcgccctgtggcaatgcccaacgtct tgctaggtcgcaaatgttgcagcagagcagttgccatgtgatgcaacaac aatgttgccagcagttgccgcaaatcccccagcaatcccgctatgaggca atccgtgctatcatctactccatcatcctgcaagaacaacaacaggttca gggttccatccaatctcagcagcagcaaccccaacagttgggccaatgtg tttcccaaccccaacagcagtcgcagcagcaactcgggcaacaacctcaa caacaacaattggcacagggtacctttttgcagccacaccagatagctca gcttgaggtgatgacttccattgcgctccgtatcctgccaacgatgtgca gtgttaatgtgccgttgtacagaaccaccactagtgtgccattcggcgtt ggcaccggagttggtgcctactgataaggaaagatctctagtaatatata attgggtcaccgttgtttagtcgatggatatgtcgatgcagcggtgacaa ataaagtgtcacacaatgtcatgtgtgacccgcccaaactagttgtttaa attctgaaataaaataaaaataaagttgtatcaaaaaaaaaa
Download
page-top