Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231966
Length 498 bp
Fasta Format > whe10f13
aacaactcaccatttttgcagcaacaacaacaaccaccatttacacagtc aacaacaaccatcgttttcacaacagccaccaatttcacagcagcagcag cagcaacaacaacaacaacaaccatttacacagcaacaacaaccaccatt ttcacaacagccaccaatttcacagcagcaacaaccaccattttcgcagc aacaacaaccaccattttcacagcaacaacaaataccagttattcatcca tctgttttgcagcagctaaacccatgcaaggtattcctccagcagcagtg catccctgtggcaatgcagcgatgtcttgctaggtcacaaatgttgcagc agagcatttgccatgtgatgcagcaacaatgttgccagcagttgcggcaa atccccgagcaatcccgccatgagtcaatccgtgctatcatntactctat catcctgcagcagcagcagcagcaacaacaacaacaacnacagggtca
Download
page-top