Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231965
Length 574 bp
Fasta Format > whe10f12
aatctgcgcagctccagcagcggcggcgcctctccggcggcatggccaag gtaaggagcaggaggagggcccaactggaacggcctgctcaagtggagcc tcgcccacggcagcgacggcaccaacccgccccgcgcgctcagcgaggag gacaggaaatggtttatggaggcgatgcaggcaaatacagtcgatgttgt tggcaggatgaaggagattgcccaggtgatgaaaacccctgatgatgtgt tgcagtctcatggcgtcactccagagaacattgaagatatgcttgatgag ttacaagagcatgtggaatccattgatatggcaaatgatcttcattctat cggtggactagatcctctacttggttacttaaaaaattcacatgctggca tccgagcaaaggcagcagaagttgtgagtacggttgttcagaataacccg aaaagccagcaacttgtcatggaatctaatggactggagccactattgac aaacttcangtctgatcctancacgactgcncgcacaaaaagctcttgga gctatctnttctntgattcnnaat
Download
page-top