Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231962
Length 612 bp
Fasta Format > whe10f09
ggcctgtccaaancgcgtgatccatttccgcctcctcgcttccttctcgg tctcggtgcgtgcgccactccgtcggcccgtccccctcaccggcgacttc tcgcctcgcggccgctcccagccccagggcagcgtgggcgcgtgtgttgc gagccatggccggcgagaagaagatgttcggcttcgaggaggtcgccaag cacaacgtcaccaaggactgctggctcgtcatcgccggcaaggtgtatga tgtcaccccgttcatggatgagcatcctggtggagatgaggtactgctgg cagtaacagggaaagatgcaaccagcgatttcgaagatatcggacacagt gattccgcaagggagatgatggagaagtaccacatcggggagattgatgc ttcaaccatcccagcaaagcgtacatttgtacctcctcagcaagggtccc atgtccaggccaaggatagcgacctcctcatcaagatcctgcagtttctt gttcccattttaatcttggggcttgcatttggtatccggcactacagcaa atctgagtaggctgttgttggcgagttgcttcagagaaatagctttcaag taatatggtttg
Download
page-top