Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231958
Length 631 bp
Fasta Format > whe10f03
aaatcccaatctcgatcatcggccgaaccctaaccctcaccccccaaatc cacaatcccggacggcgacgatggccgccggcaacccccgcttccccgac ttcgccatcctcgacgccatcgcctacatcagcgatctccgcgacgcaac cgccgcgtggaccttgacgacggcgggcctcacccttcaggtctccttgg tggtggccgctccgccgcgcctctcctacttctgcgtctgctgcgtcggc cgcgacaagaccaccttcacggacgcgccagatgtcgtctgctccgtggg ggaccacgccctcatccgggttggcttcaccaccggcgactcgacggagc acttcatctaccgggccagggggcccgatggacggccgtcgcttgatctg ctcccggacttcgatgattatactgacgcagagaatctgctgctgcccct cggtttcgtctcccaccgcaagcacttggtcatagcggccctgagcgacg gaccgacggacctgcagtactatctccacacccgcagcaccgagccgcac tccagatggtccaagaagctgctgcgggtggagttcccccgtggagcagc caggaaatcggctatgaacgatcccgtaaag
Download
page-top