Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231952
Length 657 bp
Fasta Format > whe10e10
aggaattcggcacgagggcggtcggggcggccggcaaccgcgtggtgagc ggcgtcatgtccatgaccttcctctcgctgtccggcgccatcacgctcgg cggaaccttcttcctctacgccggcgtcgccgtgctcgcgtgggtgttct tcttcacgtgtctcccggagacgcgcggccggacgctggaggagatgggc agtctgttcggcatgaccgacacggggccggaggcagaagatgctgcccc cgggacacaggacgcgagctgcagggcgagactcttgattaatcacatga atatttggggctcagtacatagaaaggtgtgtgtaggacacatctaaatg ttatgtcacgtctaatctgatgttcattatgtttgtggtttactttattt tgtttgttgttgttacgtttatttgtgagagtttagatgcgacatcctta gaaaacatttagatgtgaattagacaaactgaggtttatatatgacacat ctagatgtgacatctaagctaatgtccactctgtttgtggtcaatttttt tgtcctattttttattgctgcattatatgtttgtgtgagtttagatgtga cattcttaaaaaatatctagatgtgaattagacaaactaatataaaaata tgccgcc
Download
page-top