Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231945
Length 611 bp
Fasta Format > whe10d17
ttcgcagcaacaacagccccatattcgcagcaacaacaaccaccattttc gcagcaacagcaaccaccattttcgcagcaacaacaaccaccatttttgc agcaacaacaacaaccaccatttacacagcaacaacaaccatcgttttca caacagccaccaatttcacagcagcagcagcagcaacaacaacaacaaca accatttacacagcaacaacaaccaccattttcacaacagccaccaattt cacagcagcaacaaccaccattttcgcagcaacaacaaccaccattttca cagcaacaacaaataccagttattcatccatctgttttgcagcagctaaa cccatgcaaggtattcctccagcagcagtgcatccctgtggcaatgcagc gatgtcttgctaggtcacaaatgttgcagcagagcatttgccatgtgatg cagcaacaatgttgccagcagttgcggcaaatccccgagcaatcccgcca tgagtcaatccgtgctatcatctactctatcatcctgcagcagcagcagc agcaacaacaacaacaacaacagggtcagagtatcatncaatatcagcaa caacaacccca
Download
page-top