Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231940
Length 615 bp
Fasta Format > whe10c18
cagaccggccgaggaggaagaggaaggtgagatggctcgcggcacggcgg cgacggcggcggcggctgccaagggcaagaagaaggggtccgtctccttc gtgatcgactgcaccaagcccgtggaggacaagatcatggagatcgcgtc gctggagaagttcctccaggagcgcatcaaggtcgccggcggcaaggccg ggaatctcggcgactccgtcaccgtcacgcgcgacaagagcaaggtcacc gtcacctccgacggcgccttctccaagaggtacctcaagtacttgacaaa gaagtacttgaagaagcacaacgtgcgggactggcttcgtgtgatcgcag ccaacaaggagcgcaacgtgtacgagctccggtacttcaacatcgctgag aacgagggcgaggaggaggattagagtgcattgttatattgtagtgcttg ttgagttttgatacttgatctgagtacctcctagttatccacctatctta tgttgtgctctgttgaacatgaatggtttaatttgaagaatccttatatt ttgcctccccttgactgtgggtccatatgtctgaacctatagacaaatat tatggagatttgttc
Download
page-top