Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231939
Length 133 bp
Fasta Format > whe10c17
cctcttcgcggncctcctagtcttcatctttgccgccnttgccgccgnng gcaatgaagattgcaccccatggacgagtactctgatcactccactccca agctgccgtaactatgtggaagaacaagcatgt
Download
page-top