Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231930
Length 381 bp
Fasta Format > whe10b11
cccccaaattcgcccaacaccttgcgggaaccccaatggcgagctttaac gccgccggcgccggcgccgccaaccccaaccctaacaaatccctcgaggt gaatccggcgcccggggactcggtttccagcctcagcttcagccccaagg cgaaccacctaattgccacctcctgggacaaccaggttcggtgctgggag ggnnagnctggcggccaatgccaggccaaggcgtntatttcgcacgatca gccagtcttgtgctctgcctggaaggatgacgggactactgttttttcgg gaggttgtgacaaagtggtgaagatgtggccgctgctgtctggcggccag gccacggccttctcagggcatgaggcgccgg
Download
page-top