Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231927
Length 626 bp
Fasta Format > whe10b04
gcctgctcctcgcagcgctcctccagctgctttcggcccctccgcggcga cggccggcgacgtcgccactggcaggggcagcgagaaggtgcacgtggcg atctactacgagtcgctgtgcccctactcggtccgcttcgtggcgaacca cctcttcaaggcctacagggacggcctgctcgacgccgccaatctcaccc tcgtcccctatggcaacgccgtggtccgcaatgacggcaccatctcctgt cagcatggccccgaggaatgccttctcaacaccgtggaggcttgcgccat cgacgcctggccggacgtgaaggtgcatctcggcttcatttactgcgtgt cggacctggtgttgaagaacaagcaccgggagtgggagtcgtgcttccag aaacaggggcttgacccaaagccagtcacggagtgctacaagggcgagcg tggccacaatctatcgctcgagtatgggagacagacagctgagctcgtgc ctcctcaccagttcgttccatgggtggtggtcgacggcaagccgctctac aacgattacgggaacttcaaagcttacatctgcaaggcgtacaagggcta tcccctcctcgaggcgtgtcgaagcc
Download
page-top