Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231926
Length 663 bp
Fasta Format > whe10b03
tacaaatcccctgaagacctttctcatccttgcactccttgctattgtag caaccaccgccacaattgcagttagagttccagtgccacaattgcagcca caaaatccatctcagcaacaaccacaagagcaagttccattggtacaaca acaacaatttccagggcagcaacaaccatttccaccacaacagccatatc cgcagccgcaaccatttccatcacaacaaccatatctgcagctgcagcca tttccgcagccgcaactaccatatccgcagccgcatctaccatatccgca gccgcaaccatttcgaccacaacaaccatatccacaaccgcaaccacagt attcgcaaccacaacaaccaatttcgcagcagcagcaacaacaacaacaa caacaacaacaacagatccttcaacaaattttgcaacaacaactgattcc atgcagggatgttgtattgcaacaacacagcatagcgcatggaagctcac aagttttgcaacaaagtacttaccagctggtgcaacaattgtgttgtcag cagctgtggcagatccccgagcagtcgcggtgccaagccatccacaatgt tgttcatgctattattctgcatcaacaacaacaacaacaacaacaacaac aacaacaacaacc
Download
page-top