Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231917
Length 694 bp
Fasta Format > whe10a07
gaggaattcggcacgaggagaaggagcaggcggcggtggtgcccgaagac gagaagcacggcgacctagcccgagctcgcaaccatggctaggggtttga agaagcatctgaagaggctcaatgccccgtctcactggatgcttgacaag cttggtggagcttttgcccccaagccatcatctggtcctcacaaggccag ggagtgccttcctctgatcctcatcctgaggaacagactgaaatatgctc tcacctaccgtgaagtgcagtctatccttatgcagcgtcatatcatggtt gatggaaaggtccgcactgacaagacctaccctgctggtttcatggacat catttccattcccaagactggtgagaactacaggcttctgtatgacacca agggccgcttccgccttcactctgtcagggatgaggatgctaagttcaag ctctgcaaggtcaggtctgtccagttcggccagaagggcatcccctacct gaacacctatgatggccgcaccatccgctacccagaccctctcatcaagg ccaatgacactatcaagctcgacctggagaccaacaagattgttgacttc atcaagttcgacgttggtaacgtggtcatggtgactggcgggcgcaacac tgggcgtgttggtgtgatcaagaacagggagaagcataagggaa
Download
page-top