Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231916
Length 604 bp
Fasta Format > whe10a06
ggtcatcttcttcctctgctcctgctcggatcccataccctgctcctcaa cccccttcgcggcgcggcgcggcgcggcacagcacagaggagtcggcgga gatgtcgggagtgacggcggacgaggacaagaagcccgcgggcgacggtg gaggcgcccacatcaacctcaaggtcaaggggcaggatggcaatgaggtt ttcttccgcatcaagagatccacacagctgaagaagctgatgaacgctta ctgcgaccgtcagtctgtggatctcaactccattgctttcctttttgatg gtcgtaggctccgtggtgagcagacccctgatgagcttgagatggaggaa ggcgacgagatcgacgccatgcttcaccagaccggagggtgctttcctgg cccttagaaggagcttgctgcagcctggctgttctatgtcgtatgctacc tttagaactagagtaaaatgtaagaagtgaaagaacttgtgaggctatgg ttctgtgccatagcctgagggggggtctggaggtgaaacaacatcggagt actgttgatgtcgtgactgaactatcatccattgcctaatatatcatgcc ttgt
Download
page-top