Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231914
Length 648 bp
Fasta Format > whe10a02
aggaattcggcacgagggagaactttgattttctatctgtaactggtgga gatgttgctggaggaactactgggcaacttgaattgttatctaccgctat catggatggatggatggctggccttggtacagcgcagcccccaagcactg atgctctaggccagctgttatctgagtacagcaagcgtgtttacacatca cagctacaacacttgaaggacatagctggcacattggcaacagaggaggc tgatgatcctgttcatgtcagtaagctgcgctctgctctggagtccgttg atcataaaagaagaaagatcatgcaacaaatgcggactgatactgccttg ttaaccaaagaagaaggtggttcacctatccgaaatcctccaactgctgc tgaagatgcacgattagcatctcttatatctctagacaacatcttaaagc aagtcaaggaagtaataaaacaaagctctacaagaccattacgaaaatca aaaaagaaagcattgctagaatcattagatgacctattggcacagatgcc ttctcttcttgacattgatcatccatgtgctcagaagcagatcacggatg cacacaatgctgtagagtcactgcaagaagaccccgatgatcctgccc
Download
page-top