Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ228976
Length 618 bp
Fasta Format > rwhdl9d02
taacctcntccgaaagtacacgaacaaaataagataactgaacgctggct aggaatgtcgacagaagtactcaagaaatcagccatcaaaactgactaca aagttcacgacacccaggtggcacatatatcatcttctagatatgaagca gcaaaatagcgacttctattttctactcagcagcagcaacctcctccgct ccaggaatcacctcatctccatcagcaggcctgtcaagcttcacaccaac atcctccttgtagtcaccgtgcacctccatgagcttccccaggtcaaact tgggggccttcaggatcttcaccttgcggacgtacacgttctggaggggg aagatgcttgaggtggccttctcaatctcctttccaatcacctcagggat gaacttgttcacaagctccttcaagtcacagcttgcagcttggttgacca tgatctcaaccatcttgcggcggatctgtctgatctgacttgcttgggca tagcaagtgcgcttcacctggtttgggcgtctcttcgtgaagccaatggt gaacatgcggagcatgtagttgtcagtggtcttcacatccacatgagcct caatgagtgtctgccact
Download
page-top