Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ228938
Length 638 bp
Fasta Format > rwhdl8p02
gaaatgaaactgcaaatgggtntaaatgtttacaatctctgatgtcacgg cggcagaaggatttcaagtactctaaaacatttagctagaagggactaaa ccattgatcataaccaccaacaaaaatattttccttgtttacagaacacc atctcacttcgcacttccgtttcaaacagattactttgaggtcgtcttgt ccttggtcttctgtattttcaacaccttcttcacgatcttctgctcctca accaagaaagcgcggatgatcctttccctcaccgcagttccagagagcac tccaccatagggacggttcacagtcctgcggttcctagacaaccttgatc ttttgtattcagtaggcctgaggtggggaatcccctggatcttcttcccg gtcacagggcacttggggccgctcgccctcttcttggtgtactggtacac gagcttaccacctgcggtacacaaggaacaaaaccgaccgatttcagcga agatcttggcacgaacaaatcagaagccaccaaattatgggagaaaatcg tccagaaaagagggggaggggatccagacctggggtcttgacgacccgcg tctggttggacttggtggcatagctgtgcctcttccgg
Download
page-top