Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208657
Length 542 bp
Fasta Format > wh10c20
ttcggcacgaggcaagnaggatcgtcagcctgtctgggcgcggcaaggga ggcaaggggctcggcaagggcggcgccaagcgccaccggaaggttcttcg cgacaacatccagggcatcaccaagccggccatccggcgcctggcgagga ggggcggcgtgaagcgcatctccggcctcatctacgaggagacccgcggc gtgctcaagatcttcctcgagaacgtcatccgtgacgccgtcacctacac ggagcacgcccgccgcaagaccgtcaccgccatggacgtcgtctacgcgc tcaagcgccagggccgcaccctctacggcttcggcggctaggccgcgcca gatggtcgtcagtcctcgtcgccgcctgcagattccgctgtgttagtccg cccgttcctagtagtgttgcgctcaagaaatctcagatggaaaccgcctt gtttcccatttcctctgtctgtttagctggatcatgaaattatgtactgt aatgaagatgtttgcatccagagttcgaactgaaaaaaaaaa
Download
page-top