Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231791
Length 710 bp
Fasta Format > rwhdl4f12
aacaaaataagnataactgaacgctggctaggaatgtcgacagaagtact caagnaaatcagccatcaaaactgactacaaagttcacgacacccaggtg gcacatatatcatcttctagatatgaagcagcaaaatagcgacttctatt ttctactcagcagcagcaacctcctccgctccaggnaatcacctcatctc catcagcaggcctgtcaagcttcacaccaacatcctccttgtagtcaccg tgcacctccatgagcttccccaggtcaaacttgggggccttcaggatctt caccttgcggacgtacacgttctggagggggaagatgcttgaggtggcct tctcaatctcctttccaatcacctcagggatgaacttgttcacaagctcc ttcaagtcacagcttgcagcttggttgaccatgatctcaaccatcttgcg gcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttcacct ggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatgtag ttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgccactt cctcacaagagacctgagcttgtcagtggtgaagtccatgccccagaagt ttgtgaggacattcatcccttgcacatcctcagcacggagtctgatcttt ctgtaggcct
Download
page-top