Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ614707
Length 603 bp
Fasta Format > rwhvd20g17
acttgcttcttgtattgatgaggggcttataaagccaattacaaatcgga gtaaaacaaaacaattcaaactgaatttggagacagcaggaaaaccttgt tcggggcgaacctttccatatccaaactcttatagtattctaaactaaca ataataactagggataactagtcacggcatgggttcgactttgattgtag tatcagacacactaacacccctataaatgccatctgtgaagtggtgagta acttcgtgtccattcagcagaacatccttctgcgtatatgagtatgggac atcacatataccttgtgactgagtcgccgtcaccaagaccttggacattg gaggcacaatgacttgatatttcatggtggtctcttgtgtcttggttata gtttctccccagctatatcctccttcaaattcagcactaatttctatttc ccctttcactatgagtggaatcccagattcaatggttgacttgacagcca ctttcaatgaaacagagagagagagagagagagagagagagagagagaga gagagagagagagagagagagagagagagagagagaganagagagagaga gag
Download
page-top