Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ614256
Length 175 bp
Fasta Format > rwhvd19k11
acgtggcnaacaagggngcgaacacgagggactcgacggccatcagcttg atgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat ggtgtcgccgatcacggccgccttgtggcagtctgaacccttggggccaa gggacctcncntgctcnctgttgcc
Download
page-top