Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ613352
Length 684 bp
Fasta Format > rwhvd16g23
aggcataatgcccagcaaataaccaatacacaagcgcccataataagtaa acaaacttaacaacatccaggacctgactctgaaccaaactgaaacacaa gcatccgtcactgaacgggcttcacggaccgaaccttcaaagacgatcaa cccctcccaccttgacaccaacttaacgtaaagcaaacacaacacacgcc aacaattcaatcgaggtccggtcacgagtctcgggcacggcggcgatcaa gcgctgggcttgtgctcgcctgcagcggcggcggccttgtcctcctcccc tgtcttgtggtaaccaggcagcttgtccatgatcttgcccagtaggccct tcttctccttcgcgtcagggctgctcacctcctcggcggctggcgccggc gcgtgcactggtgctggagcagcgtgcgtgacgggcaccggagcagcgtc ctccggtttcttgtggccgccgggcagcttctccttgatcttttccaaga agcctttcttctcctcctcgggcactgccggtgccgcctctgtcttcacg tcaccgtcgatcttttcgacgacgacgtcggtgtcatggtgggtctgcac agacgcgggggccgccggtgcgggtangnccntnangtgctcancctcng ngtnnttgtggncnnnnannttnnnnttganntt
Download
page-top