Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ613246
Length 505 bp
Fasta Format > rwhvd16b13
atgcttattacatcggatagctcgccatagcaggacacaacgacaggaca gaaactaaacacacactcacggacacatcaccaaccgcacacgactttta ttctaacgacacggcaacagatcacaggccgatctctaccaactccgggt cacggtggcgatcaactcagcttcagcagcatgacacgtttaccagggaa ggatcttccagcgctggttgtcgccctcgcaccacttccacagcacgagg gaggtgccgtcgcgcacgccgccgtgctccttgtcgccgtggagagcgtc aaagttgaggtagatgttattcaccatgcggatgcaccggaagccggcgc ccacgtcgcggctctcagtccacaacactgactcgtcctggtagttggcg ttgtatggcaccagcttcacagggtggccctcgccttgggagtgcttgat ggcctcgcctgtcaccttgttgacgagggcgaaggccgggtagccttcct cgtcc
Download
page-top