Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ613147
Length 583 bp
Fasta Format > rwhvd15l21
ggcaggatgcatgtgtagcacccgaacctttacatgcatagcatagacat ggagtagacaattgaatagctaggtaccgtgcaattattcattacatata tataatataagtagagatgcacggagtcacacaaagatgatggaggtgca cggcggctggatcatcagatgatagggtaaagcgggtacttggcaatgcc gcacaagcccaagggtggcgagtccctaaggaaatagacgaagcctttgt cgccccactggtcagtccacgagttcttgccaatccagtacttggtcccg tcaggcttggtcccgtacccgacgatggccagcgcgtggttctgcgttgt cccgcacgcccctttgttgtacacgcccgacctggagcaaccggcgttgt acacgccgcggatgtagtgctggaagcaggggtcactgtagtcgaaggat gcggcgacgggctgctgcgccacggccgccatcancgccgcctcntcacc gggtggtgaaatcttcttgtancctctgancttcaccgcnaccggcttgg ccctttgncacntgcccaccttgccngngnnng
Download
page-top