Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612801
Length 704 bp
Fasta Format > rwhvd14j04
ctctttgccatagaaagacaacatgacaacggattcgagacttcatcaga aacagtacagctacttcatatatgtagcatagatgtaccgatgcaattct acagttacaacaactagtgccataactaggacattgtatggataaatcat tgtacacgaacaatcacggaactagatagcgacatagtaacaacaatgct ctcttgtctttcttcattcctcgcacagagagaagggggctttgaagagg attattctacaaaaattgctctacagcaggaatcctctaccctcattgca aaggaagatccttgtgggtgtacacaactcccttgtcgccgttcactact tgtccactccctcgaagaatgcaccgagtggttaaaagaccgtcgacacc aacaggtccacgagcatgtatgcgccctgtacttatgccaacctctgcac ctagaccgaagcgagtcccatcacagaaccttgtgcttgcattatggaac acagcagcactgtcaacttgttgtagaaaagtatctgctgacttcttatc agttgtgataatacaatctgtgtgtgcacttccataacgatttatatggt caatcgctgactgcacatcatcaacaaattcgagggtgcatgccattgag ctatactcatgatgaaatgaatccacctttggtactttcaatgtgtcatg tgcg
Download
page-top