Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612685
Length 810 bp
Fasta Format > rwhvd14c13
ccgatacattcatttcaggtgctctttgccatagaaagacaacatgacaa cggattcgagaattcatcagaaacagtacagctacttcatatatgtagca tagatgtaccgatgcaattctacagttacaacagctagtgccataactac gacattgtatggataaatcattgtacacgaataatcacggaactagatag cgacatagtaacaacaatgctctcttgtctttcttcattcctcgcacaga gagaagggggctttgaagaggattattctataaaaattgctctacagcag gaatcctctaccctcattgcaaaggaagatccttgtgggtgtacacaact cccttgtcaccgttcactacttgtccactccctcgcagaatgcaccgagt ggttaaaagaccgtcgacgccaacaggtccacgggcatgtatgcgccctg tacttatgccaacctctgcacctagaccaaagcgagtcccatcacagaac cttgtgcttgcattatggaacacagcagcactgtcaacttgttgtagaaa agtatccgctgacttcttatcagttgtgataatacaatctgtgtgtgcac ttccataacgatttatatggtcaatcgctgactgcacatcatcaacaaat tcgagggtgcatgccattgagctatactcatgatgaaatgaatctacctt cggtactttcaatgtgtcatgtgcgacaggcccacccataaataacaact ccttctttcgcaaggttccatcaataaatcatcaagaccctctgtcttgt tcanatcttt
Download
page-top