Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612624
Length 494 bp
Fasta Format > rwhvd13o23
atggaacggaaagagtaaccatctaggtacaagcaggggcaccccgcgga agaggacatacaccctccaccactanggcatccccgccggcggcggcgcc aacagggagcgctatccgttatagcaggacaatgacaggaaaaaggtaaa acaacatcacgatgtgaagtgaaacttgggataattctagtggagatgga taggctccttatgacaccaccgcacacagctcaggtccgttctcgcacag cagctcccgacttgtccgccggagcagccttgacaagatgcgtcttcttc actcgtcatcgtcctcgtcctcatcgctgccctcatcgncatcgtcgtca ttgatctccgacttggacttgtcagattcctcctcatcttcctcctctac ctccttggccgcagccttctttggggcagcagcagcagcgctctcgccct tgttgtaggcagcantggccttgttgtantcgcccttgaagctt
Download
page-top