Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612500
Length 192 bp
Fasta Format > rwhvd13h11
aagagaagtcttacagggtgaatacacgatcagaacagagttctggtatt attgggtaaacataactgtgcaatctgtacgtacgcgtacatacatacat gcacctaccttcttattgaccacatatacgagtagttactacgtgcaggc aagtagcaacgtccgtgtggagcatctggcacttagttgcgg
Download
page-top