Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616921
Length 537 bp
Fasta Format > rwhvd9p15
ggttctcataccaccaggtagccaggaaatacaagctgagacatacagca gacagaatcacaggtaccaataatttccatgtgggcttattgcaagttaa taaaaaagggggcttttcctctgtctacgctaagacagatttctcccagt gttgaaattgaaaccaaaccagctcttctagttggccttggtttcagtga ccatcttcataaaaatctagttagccttggcctcaatgaccctcctcgca aatgatggcaaacaaaacgatgcggtgtggaactcggaattgtagaactt gagcggcccctttgattttgtggagtattcgtcctcctcgatgctgaaga cgggatgctggaaatcaacactaggtccctccgtggagcagagcatgaaa cctatcactccgcttgggtatgtgggcaccgtagtccatgcgtagttcac cgagcctttgaaaacctggcgacagttggtgacaatgtcctctatgatgt gcatgtgcagccatatgctctccgcctgggtgcagac
Download
page-top