Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616741
Length 612 bp
Fasta Format > rwhvd9f04
aaactttgcagcagcatccgaccatatccccacaattcatctacgacgga atggaaacttgaaacggagtaccgaatggtggtagcgccgtgatgtagca aacaaaaaccaaacaggaggcaaatacacatggcagtgtcacttattcgt cggaggacgaagccgacttcttcttggcgacggaagccctcttccccttg agcgtcctgcagttgttctttgtcctctggccacggaccgggaggccgag cttgtgccggatgcccttgtagcaccggatctccttcatcctctcaatcg ccacacggttgaaccgtttaaggtctccttcaatcatgtacttggtgacc tccttacggagcgtgatgacctcctcctcggagaggtccttggtgacctt gttgtcgaagctgaggtccaaaaggatctggcgggagcggttccgcccga tgccatggatgtactgcagcgagtactccaccctcttgtggtttgggatc tcaacaccaccgatacggatgcactcgatccgcaggccgccgtgaccaat gcctcccttcttgggggcggggaggganacngangangcncnncnnnngn tgnanangnnna
Download
page-top