Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616728
Length 821 bp
Fasta Format > rwhvd9e09
ttttcacagtccaaaaatatataactaacatcttcgggcatgtacgcgcc taaacggcttttcagttttgctgcacaatacagggaaatgaaaccagaaa gaggtctagcttgtgaatggaagctacatgggattacaaagctgccagtg cacaagacatgtggggtacaacttgtgcatacagactggaaagaatagga tctgactatataacgtagcaaaatgatacaagtttggattcttctcttat tcaagctgttcatcatgaaaaaaatggacttttatgaacaaaatggatca atgggtggcatctctgctgtagaactgatccaaggtcttcgcaggaatac ggtggagaagttcacgggggaatatgcgtagcaatgtccatgccagatca agtgactgaaaaatgttccgagtatcgtatgctccttgcgctacaaattt cctctcaaacttatcgaggaattctaaatagagcaggtcctcagatgaaa gagcctcctctccgacaactgctttcatggcttgaacatccttcccaatg gcgtagttggcatacagctgattggacacatctgaatgatcccggcgtgt cataccttcaccaatagcactcttcatcanacgagaaagagatggcagga cgttgatgggtgggtatatctgtctattatgaanctgtctgtcatatata tctgcccttcngnaatgtatcccgtaanatcangagttggatgggtgata tcntcnttanngcattgtaanaatangaattttgggnaattgatcctttt cttccctcnatacncccnnct
Download
page-top