Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616716
Length 500 bp
Fasta Format > rwhvd9d16
aattttgtgacattcatgggggatcaatatcatgagtaggcgaggaagaa acaataacagaagctaaaatataaaccgacaccctgggtttagattacta gatacacacacaaacacacattgttgcctcgattgtttcctctccaccga tcaacccacgtacgcatgcacacaagatgagtatcttcacttctgctctg ctctagttagactcgagctgcgcgtaccacacaccctggatcttgacatc cttgggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcga agacgccgatcacctcgccggtctccggcttgctcttggtgacgctgagc gtgatgttgcccgtggaggaggacgcgttcttcacgttctccttggccaa ctcctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcgt agccagtagagccaccacggccctttgggtcgaggaaagacgaacccctg
Download
page-top