Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616546
Length 647 bp
Fasta Format > rwhvd8j11
agcggcacacgtatgcgaatattgaatgacacgcggataccgaatgctag ctagacagagagaccgaaacccctgaacttagcctcggtaatggcgtcga tctttcgtgctgtctccggcgacagatagttctcccagtccccgaccagg ccgcgccggaagaacgagctgttctccacagcgcccaacacaagctccgt cttgccgctcttggtcacttcgagcccggtcatgtgctcgaacgagcaca gcttgacgacggcgtccaccgcgccatcttcctcctcctccgcgctgaac gggcgtccgacaaactccgccagcctccggacgtgggctgcagggtcccg actcatctcctcgtacctgaagaagagcacccgctcggggttcgccaggt gcgcgcgccagtacccgagggcgtggtcccagtacggcccggacgccgac acgccgtcgcanaagtantcggcggcggtctcgaccganatcggctccag cccgtcctcggccctgaacttgttcacgaangtccacgtcnagaccangg tgtccttggggtcnngnnanacntannnnatnntgnannncnannnnnnn annganctnnnnannnannnnannnnnannnnnntgnnnangannnt
Download
page-top