Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231309
Length 614 bp
Fasta Format > rwhdl26f07
ataagatcnagctaaacacagagtcttcttcatgggcaataccaaaacag gacaccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgta aagggttcgggtagtaataacggcagagaccgccctggcgcggccggccg gcctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaa cctctcctcgagcttggccttggcggccttggcggcgcccaccttcttgt ccttggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcg acgtcgagggtatagcgggtgggcatgagatgggtgaagttgacgagctt gaggaacaccttgacgcgggacttcttggccgtcttcttggccgagtcct tgcggatcaccttcttcgggtacttggccagcccggcgacgaggcagtgc ccgtacgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgc cttcttccccgcgtacctgccctgcagcaggatcaccgccttgccgggct tcaggaacttcaccatcttcgcttccttcctcaagctgcgctgcgccgcc gccggtgggttggg
Download
page-top