Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ615703
Length 413 bp
Fasta Format > rwhvd5f20
tatgtgataggccacccctagagggttgtgccggttccccccaaagccta ttgtcttacactgtgcatgcgtatttcattgtttttacgtatcacgaagg tcctttattgttacgtaacttgtcattacacacacaagcacaacagctcc gttattctgcggggtaggtagcgagagacgcatgcatgttgtctatccgg gacggtccacatgacatcgtttcttcagtagatacgtacgtacgcatgtg tggatatctcgatctccccgcgtacgtgcacgagccatgcatggcgcgcg ctggctggctggctcagtagtacggctggagcttccagcgctggttgtcg ccctcgcaccacttccagagcacgacctcngtgccgtcgcgcacgccgcc gtggnacttgtcg
Download
page-top