Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231201
Length 636 bp
Fasta Format > rwhdl25n19
gaaagtaacacgaacaaaataagataactgaacgctggctaggaatgtcg acagaagtactcaagaaatcagccatcaaaactgactacaaagttcacga cacccaggtggcacatatatcatcttctagatatgaagcagcaaaatagc gacttctattttctactcagcagcagcaacctcctccgctccaggaatca cctcatctccatcagcaggcctgtcaagcttcacaccaacatcctccttg tagtcaccgtgcacctccatgagcttccccaggtcaaacttgggggcctt caggatcttcaccttgcggacgtacacgttctggagggggaagatgcttg aggtggccttctcaatctcctttccaatcacctcagggatgaacttgttc acaagctccttcaagtcacagcttgcagcttggttgaccatgatctcaac catcttgcggcggatctgtctgatctgacttgcttgggcatagcaagtgc gcttcacctggtttgggcgtctcttcgtgaagccaatggtgaacatgcgg agcatgtagttgtcagtggtcttcacatccacatgagcctcaatgagtgt ctgccacttcctcacaagagacctgagcttgtcagt
Download
page-top