Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ615230
Length 517 bp
Fasta Format > rwhvd3i05
gagtggttaaaagaccgtcgacgccaacaggtccacgggcatgtatgcgc cctgtacttatgccaacctctgcacctagaccaaagcgagtcccatcaca gaaccttgtgcttgcattatggaacacagcagcactgtcaacttgttgta gaaaagtatccgctgacttcttatcagttgtgataatacaatctgtgtgt gcacttccataacgatttatatggtcaatcgctgactgcacatcatcaac aaattcgagggtgcatgccattgagctatactcatgatgaaatgaatcta ccttcggtactttcaatgtgtcatgtgcgacaggcccaccataaataaca actccttctttcgcaagttccatcaataaatcatcaagaccctctgtctt gttcagatctttatgaacaagcagtgtttccatagcattacacgctgcag ggataatcaacctttgcatccaatactatacgttttgccatgtccatgtc nanctgatttatcaata
Download
page-top