Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612302
Length 659 bp
Fasta Format > rwhvd12l18
gctacttcatatatgtagcatagatgtaccgatgcaattctacagttaca acagctagtgccataactacgacattgtatggataaatcattgtacacga ataatcacggaactagatagcgacatagtaacaacaatgctctcttgtct ttcttcattcctcgcacagagagaagggggctttgaagaggattattcta taaaaattgctctacagcaggaatcctctaccctcattgcaaaggaagat ccttgtgggtgtacacaactcccttgtcaccgttcactacttgtccactc cctcgcagaatgcaccgagtggttaaaagaccgtcgacgccaacaggtcc acgggcatgtatgcgccctgtacttatgccaacctctgcacctagaccaa agcgagtcccatcacagaaccttgtgcttgcattatggaacacagcagca ctgtcaacttgttgtagaaaagtatccgctgacttcttatcagttgtgat aatacaatctgtgtgtgcacttccataacgatttatatggtcaatcgctg actgcacatcatcaacaaattcgagggtgcatgccattgagctatactca tgatgaaatgaatctaccttcggtactttcaatgtgtcatgtgcgacagg cccaccata
Download
page-top