Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ612194
Length 373 bp
Fasta Format > rwhvd12f05
ggcttattaatttcattgcgcacagccagagagaggacctctcgctcgct cgatcatggtacaaataaacacacaaagtacgtgcagctacacgttgatc cacgacgtacaagtacacatgcatatctcgtccgatggacggacggacgg acggatggctaaacacatttagcttccgggggcgaagttggtggcaaagg cccacgcgttgttgttgaccgggtcagcgacatggtcgaagaggttctca acgggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga gaacatggcgaggcggccgttcttgagctccttgaccttgagctccgcgg cggtgtcggggtcgtcggcnang
Download
page-top