Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ611752
Length 605 bp
Fasta Format > rwhvd10k18
agtaacaacaatgctctcttgtcnttcttcnttcctcgcacagagagaag ggggctttgaanaggattattctataanaattgctctacagcaggaatcc tctaccctcattgcaaaggaagatccttgtgggtgtacacaactcccttg tcaccgttcactacttgtccactccctcgcagaatgcaccgagtggttaa aagaccgtcgacgccaacaggtccacgggcatgtatgcgccctgtactta tgccaacctctgcacctagaccaaagcgagtcccatcacagaaccttgtg cttgcattatggaacacagcagcactgtcaacttgttgtagaaaagtatc cgctgacttcttatcagttgtgataatacaatctgtgtgtgcacttccat aacgatttatatggtcaatcgctgactgcacatcatcaacaaattcgagg gtgcatgccattgagctatactcatgatgaaatgaatctaccttcggtac tttcaatgtgtcatgtgcgacaggcccaccataaataacaactccttctt tcgcaagttccatcaataaatcatcaagaccctctgtcttgttcagatct ttatg
Download
page-top