Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ611624
Length 417 bp
Fasta Format > rwhvd10c03
atgggggatcaatatcatgagtaggcgaggaagaaacaataacagaagct aaaatataaaccgacaccctgggtttagattactanatacacacacaaac acacattgttgcctcgattgtttcctctccaccgatcaacccacgtacgc atgcacacaagatgagtatcttcacttctgctctgctctagttagactcg agctgcgcgtaccacacaccctggatcttgacatccttgggcgccttggc gccgaggtcggtgtctgacggctgcacgctctcgaagacgccgatcacct cgccggtctccggcttgctcttggtgacgctgagcgtgatgttgcccgtg gaggaggacgcgttcttcacgttctccttggccaactcctcctcgtntcc tctgcctcnggcgggna
Download
page-top