Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ718915
Length 772 bp
Fasta Format > whvd20m23
acggcaggtaagggaggaggagagcggcggcgaagatggtgtcgctgaag ctgcagaagcgcctggcctcgagcgtcctcaagtgcggcaagggcaaggt ctggctcgaccccaatgaggtcaacgagatctccatggccaactcccggc agaacatccggaagctggtaaaggatggtttcatcatcaggaagcctcag aagatccactccaggtctcgtgcaaggagggcacatgaggccaagcagaa gggccgtcactctggatatggtaagcgtaggggtaccagggaggctaggc tccccaccaagatcctgtggatgcggaggatgcgcgtcctgaggcgcctt ctgcgcaagtaccgtgaggccaagaagatcgacaagcacatgtaccatga catgtacctgaaggtcaagggtaacatgttcaagaacaagagggtcctca tggagagtatccacaagtccaaggctgagaaggcaagagagaagaccctc tctgatcagtttgaggccaagcgcgccaagagcaaggcaagcagggagag gaagcatgccaggagggaggagagattggctcagggccccagagatcatg caccagcaccagcggctgcagctccagctccagcagcagcggcaccaaag aaggccaaggccaagaagtgaaggtctgacatgaagctttagctttctgg tatcatgaagggttagcctgattttggagcatctgaagttcagaactgtt ttctgtgcaatatctgtgtgcc
Download
page-top