Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ717856
Length 806 bp
Fasta Format > whvd17j10
agcacagtgacatcaagctcaaggacgacaagactctgctctttggcgag aagccagttaccgtcttcggcgtcaggaaccctgaggagatcccgtgggg tgaggctggtgccgattacgttgtggagtccaccggtgtcttcactgaca aggacaaggccgctgctcacttgaagggtggtgccaagaaggtggtcatc tctgccccaagcaaagatgcccctatgtttgtggttggtgtcaacgagga caagtacacctcagacgttaacattgtctcaaatgctagctgcaccacta actgccttgctcccctagctaagatcattaatgacaacttcggtattatt gagggtttgatgaccactgttcatgccatcactgccacacagaagaccgt tgatggtccctcgagcaaggactggagaggtggcagggccgcaagcttta acatcattcccagcagcactggtgctgctaaggctgttggtaaggttctt cctgagctgaatggcaagcttaccggtatgtctttccgggttcccactgt ggatgtgtcagttgttgatctcactgttanaaccgagaaggctgcatcat atgatgacatcaagaaggctatcaaggctgcatctgaggggaagctcaag gggatcatgggttacgttgaggaggatttggtctccaccgactttgttgg tgacagcaggtcnagcatctttgatgccaaggctggaattgctctgaacg accatttcgtcaagcttgtctcgtgggtatgacaacgaatgggggttaca gcaacc
Download
page-top