Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ717508
Length 781 bp
Fasta Format > whvd16d22
gcggcggcgcgcaggcgaatcagcagcggagccaagcaaccgacgccacc atgggtatctcgcgtgactccatgcacaagcgccgggccaccggtgggaa gcagaaggcttggaggaagaagcgaaagtatgagctcggccgccagccag ccaacactaagctttcgagcaacaagacagtgaggagggtccgtgttcgc ggaggtaacgtgaagtggagggctctccgtcttgacactggtaacttctc atggggtagtgaggctgtgacccgcaagacccgtctcctggatgtggttt acaattcgtcgaacaatgagcttgtgaggactcagacccttgtcaagaat gccattgtgcaagttgatgcagcccctttcaaacagtggtacctgactca ttatggagttgaaatcggtaggaagaagaaagctgctgcagctgccaaga aggaagctgctgagggacaagaggctgaggttgctgctgctgccacagag gaagcaaagaagagcaacaatgtccagaggaagcttgagaagcgccagca gggacgtacactggactcgcacattgaggagcagttcagtggtggaaggc tgctggcctgcatttcgtctcgccctggacagtgtggcagagctgatggg tacatcctggagggcaaggagctggagttctacatgaggaagctccagaa gaagaagggcaagggtgccacagcttangccgaagagctgctgcatgtta ctcgttggattttcttanatgttgcgtccat
Download
page-top