Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ717328
Length 703 bp
Fasta Format > whvd15j11
agggttttagccgccggccatggccctctcctcgtcttcctccaccctgc tccgccgcctcctcggctccacccccctttcatcctcccgctcctctgta cttcgcgccgccttctgctcctcctcctccgcggccccctcccccacctt gcctcctccttcgaccatcttcggcgacgacaccgaggtcgccaacgtgc cgccgctcaccacccccaagctcttcgtcagcgggctttcaaggctaacg acggatgagaagctcaagagcgcgtttgctcccttcggacagcttcttga agcgaaagtcataacagatagagtttctgggagatcaaagggctttggtt ttgtaaggtacgcgagtttagaagaagctgagaccgcgcggcaggagatg aatgccaagtttctggatggatgggtcatttttgtcgaccctgcaaaaca aagggagcagaagcctgctcctcagccggatactgcttcctcgcacgctg gcttcacgatcaataaaactgtaggatggtgtggttagttgcttaggctc tcgagtcctatagatcacatagcaatggcatggatgatgttctagccaca gaaagttatggcattactgcctgtattaatacataaaacgataacgctgt tcctcttttgagataataatgttgctctttgtggcttcacactaaaaaaa aaa
Download
page-top